NON COVALENT INTERACTIONS (PRACTICE QUESTIONS) Class 12

1. What type of interactions are involved in stabilizing the secondary structure of proteins?
2. Why ionic interactions are known as salt bridges?
3. Why ionic bonds are greatly reduced in water?
4. What are H-bonds?
5. What is the relation of Van Der Waals force with atomic radii?
6. What is the most important driving force in proteins to fold into compact structures?

Back Exercise and its solutions (CH4), Class 7

https://byjus.com/ncert-solutions-class-7-science/chapter-4-heat/

STRUCTURE - FUNCTION RELATIONSHIP IN PROTEINS

 Proteins fold up into specific shapes according to the sequence of amino acids in the polymer, and the protein function is directly related to the resulting 3D structure.

Proteins may also interact with each other or other macromolecules in the body to create complex assemblies. We will understand the relationship between structure and function in proteins with the help of chymotrypsin (a proteolytic enzyme) and haemoglobin (oxygen carrying protein)

CHYMOTRYPSIN (a proteolytic enzyme):

Chymotrypsin  is a digestive enzyme component of pancreatic juice acting in the duodenum, where it performs proteolysis, the breakdown of proteins and polypeptides. Specifically chymotrypsin cleaves phenylalanine, tyrosine, and tryptophan bonds, or in other words the aromatic amino acids. It cleaves these amino acids starting from the C-terminus of the protein.

But this chymotrypsin does not cleave cellular proteins within the pancreas itself because it is synthesized as inactive harmful precursors called chymotrpsinogen (a zymogen).

A zymogen , also called a proenzyme , is an inactive precursor of an enzyme.

Chymotrypsinogen must be inactive until it gets to the digestive tract. This prevents damage to the pancreas or any other organs. It is activated into its active form by another enzyme called trypsin. This active form is used to create α-chymotrypsin

Chymotrypsinogen, is single polypeptide chain of 245 amino acids residues, is converted to alpha-chymotrypsin, which has three polypeptide chains A,B and C linked by two of the five disulfide bond present in the primary structure of chymotrypsinogen

In the active site there are three amino acids which participate in the reaction: aspartic acid, histidine, and serine forms a catalytic triad.

A catalytic triad is a set of three coordinated amino acids that can be found in the active site of some enzymes

The mode of action of chymotrypsin explains as hydrolysis takes place in two steps. 
The structure of chymotrypsin selectively cleaves aromatic amino acids due to the hydrophobic pocket at the active site. This means that only sections of the protein that are hydrophobic (such as aromatic portions) will favorably go into this pocket for the reaction to occur.

Step 1

First the oxygen on the aspartic acid draws electrons away from the histidine by sharing the hydrogen with the nitrogen. This causes the other nitrogen in the ring to take the hydrogen away from the OH on serine. The negative charge on this oxygen can then attack the peptide bond, with the extra electrons going onto the oxygen

Step 2

When the electrons from the oxygen's negative charge reform the carbon-oxygen double bond the carbon-nitrogen bond of the peptide is broken. The nitrogen takes the hydrogen from the nitrogen on histidine. This releases this portion of the protein, it has now broken off from the rest of the protein:

NON COVALENT BOND IN PROTEINS (CH 2), BIOTECH Class 12

A noncovalent bond is a type of chemical bond that typically bond between macromolecules. They do not involve sharing a pair of electrons. Noncovalent bonds are used to bond large molecules such as proteins and nucleic acids.

There are four main types of noncovalent bonds in biological systems: hydrogen bonds, ionic bonds, van der Waals interactions, and hydrophobic bonds.

The strongest type of non-covalent interaction is between two ionic groups of opposite charge

IONIC BONDS:

It involves interaction between oppositely charged groups of molecules. As we know that there are 20 naturally occuring aminoacids and among them 2 are negatively charged (acidic- aspartate and glutamate) while 3 are positively charged (basic - lysine, arginine and histidine). also known as salt bridges 

Ionic bonds are highly sensitive to pH and salt concentration means the bond strength is vastly reduced due to insulating qualities of water

HYDROGEN BONDS:

The definition of hydrogen bond is a chemical bond between the hydrogen atom and an electronegative atom as nitrogen, oxygen. In the secondary structure of proteins, hydrogen bonds form between the backbone oxygens and amide hydrogens. Hydrogen bonding confers rigidity to the protein structure and specificity to intermolecular interactions.

VAN DER WAALS FORCES:

The van der Waals force is a distance-dependent interaction between atoms or molecules. Unlike ionic or covalent bonds, these attractions do not result from a chemical electronic bond; they are comparatively weak and therefore more susceptible to disturbance. The van der Waals force quickly vanishes at longer distances between interacting molecules. These are essentially contact forces and are of little significance over larger surface area as in relation with 1/r6 where r is the inter atomic distance i.e. the distance between two atoms

HYDROPHOBIC INTERACTIONS

Hydrophobic interactions describe the relations between water and hydrophobes (low water-soluble molecules). Hydrophobes are nonpolar molecules and usually have a long chain of carbons that do not interact with water molecules. The mixing of fat and water is a good example of this particular interaction.The word hydrophobic literally means "water-fearing", and it describes the segregation of water and nonpolar substances, which maximizes hydrogen bonding between molecules of water and minimizes the area of contact between water and nonpolar molecules. For example: 

The hydrophobic effect is considered to be the major driving force for the folding of globular proteins.

SOLUTIONS (WORKSHEET 1, HEAT)

1. temperature
2. 35 to 42 C ,94 to 108 F
3.-10 to 110 C
4.Digital
5. convection
6. radiation
7. conduction
8. Maximum and minimum thermometer 
10. expands
11. breeze
12. absorbers
13. temperature
14. Copper
15. poor conductor of heat
16. conduction
17. liquid form at room temperature
18. heat
19. 100 degree Celsius
20. radiation
21. kink
22. insulator
23. Convection

24. a

25. c

26. Good conductor -: Aluminium, Copper and Iron

Poor conductor -: Air, water, wood, plastic

27. a. Joule

      b. Kelvin (K)
      c. Thermometer
      d. Conduction
      e. Insulators

28. Iron, Aluminium, Silver

HEAT, WORKSHEET 1 (class7)

1.A reliable measure of the hotness of an object is its___________________
2. The range of a clinical thermometer in Celsius scale is_____________________& in         Fahrenheit is_____________________________
3. The range of laboratory thermometer is_______________________
4. ____________________________thermometer does not use mercury.
5. Heat is transferred in liquids by________________________
6. We receive heat from sun by__________________________
7. Heat travels through solids by_________________________
8. The maximum and minimum temperatures of the previous day, reported in weather reports, are measured by thermometer called the______________________thermometer.
9. Thermal energy flows between objects due to difference in___________
10.When a liquid is heated it___________
11.Convection current gives rise to ___________
12.Dark colours are good___________ of heat.
13.The degree of hotness or coldness in a substance is called ___________
14.___________ is a conductor of heat.
15.The thermos flask is made up of double walled glass vessels because glass is a ___________
16.In solids transfer of heat can take place by ___________
17.Mercury is a liquid metal in ___________
18.The form of energy that flows from hot object to a cold object is called ___________
19.The boiling point of water in the Celsius scale is ___________
20.The transfer of energy between object that are in physical contact is by ___________
21.The ___________ in a clinical thermometer prevents backflow of the Mercury into the bulb.
22.The handle of cooking utensils are made of material that are___________
23.The vacuum in a thermos flask reduces the heat loss due to___________

24.A marble tile would feel cold as compared to a wooden tile on a winter morning, because the marble tile

(a) is a better conductor of heat than the wooden tile.
(b) is polished while wooden tile is not polished.
(c) reflects more heat than wooden tile.
(d) is a poor conductor of heat than the wooden tile

25.X and Y measured their body temperature.X found its to be 98.6 °F and Y recorded 37 °C. Which of the followng statement is true?

(a) X has a higher body temperature than Y.
(b) X has a lower body temperature than Y.
(c) Both have normal body temperature.
(d) Both are suffering from fever

26.Identify which one are good conductor and poor conductors of heat

(a) Water
(b) Copper
(c) Air
(d) Plastic
(e) wood
(f) Iron
(g) Aluminium

27. Answer the following in one word each:

(a) The SI unit of heat-
(b) The SI unit of Temperature-
(c) The instrument used to measure the temperature-
(d) The transfer of heat from hotter part to a colder part of an object due to vibration of a particles-
(e) The material that do not conduct heat-

28. Name two good conductors of heat?

HEAT, CH 4 (Class 7) Lecture 3

https://www.youtube.com/watch?v=q7wvnV8NI8E&t=69s

KVS RO Jaipur - eLearning Portal (Link of Science Subject for class 7)

https://kvsrojaipuronline.in/

HEAT, CH 4 (CLASS 7), Link to various videos

Textbook content of Ch4 (HEAT)
http://ncertbooks.prashanthellina.com/class_7.Science.Science/Ch_04.pdf

Tempaerature and Transfer of Heat:
https://www.youtube.com/watch?v=uLtWRK_Pd5c

Sea Breeze and Land Breeze
https://www.youtube.com/watch?v=L1QJlrneJUw

HEAT, Class VII (Lecture 2)

Protein Structure and Engineering (Lecture1)

https://youtu.be/g57Ce0iwtX0

HEAT, Class VII (Lecture 1)

PRACTICE QUESTIONS OF RDT (CH 1) Class 12, BIOTECH

2 Marks questions:

1. What are expression vectors? What kind of promoter should be used in such vectors?

2. Generally, eukaryotic hosts are preferred to express eukaryotic proteins. Why?

3. Why viral vectors are ideal to transform host cells with suitable transgene?
4. Starting from double stranded DNA suggest a strategy for obtaining large amounts of pure single stranded DNA for sequencing purposes.

3 Marks questions:

1. Why do we use Taq polymerase in PCR? What is the importance of primers in the process of PCR? If we started with 5 molecules of template DNA, how many molecules will we get after 35 cycles of PCR?

2. In Southern Blotting, why do we bake nitrocellulose membrane after blotting? Why this technique is called blotting technique? Name a technique used to locate RNA in a gel?

3. Schematically illustrate various steps involved in creation of genomic library.

5 Marks questions:

1. Explain with a suitable diagram, the steps and principles involved in Sanger's method of DNA sequencing.

2. Discuss any 5 methods of introduction of rDNA into host cells.

3. Write a descriptive account on SDM.

TEST (22/6/2020) CLASS VII, CH 1 TO 3

https://docs.google.com/forms/d/e/1FAIpQLSezv9OVIahuPuHvL06YoVS9XwzwU0D0ZwajuccfTJnI3FszHw/viewform?vc=0&c=0&w=1

PICTURE BASED QUESTION (CLASS 7, CH 1)

1.  Name the process shown here. What are the various raw ingredients utilized in this process?
   

2. Name the opening shown here and the two cells which are around this opening
     

3. Why these leaves have different colours?
        

4. Dear student can you explain why the covered portion of leaf is colourless?
    

5. Name the parasite shown in the given diagram and define parasite.
     

6. Differentiate between the three modes of nutrition shown here :

RECOMBINANT DNA TECHNOLOGY (CH-1, CLASS-12), 1 MARK QUESTIONS

1. In RDT, what is the advantage of using vectors with polylinkers and MCS?
2. What are expression vectors?
3. What kind of promoter should be used in such vectors?
4. What do you understand by the word insertional inactivation?
5. Name any two visual methods of screening transformed bacterial cells.
6. Why the sequence we get from autoradigram is complementary to the original sequencde?
7. In the following DNA fingerprinting gel autoradiogram, which person is most likely the father of the child?
    
8. For identifying the fragment TTATGCCGCGATTCATACTAT, after restriction digestion genomic DNA, which probe will you use?
a. ATGCCGCGA
b. GGCGTAAGT
c. TCATACTAT
d. TTAGCTATA

9. Write the sequence of the original DNA strand of this autoradiogram where each well is showing ddNTP utilized.

10. What do you mean by the word pallindrome?
11. Why type II R.E. are most commonly exploited in RDT?
12. Name the specific enzyme shown here and its specific function.
        
13.  Name the specific enzyme shown here and its specific function.
          

14. Why Yep is consider as shuttle vector?
15. Following diagram shows the infection by a M13 virus to the bacterial host where it completes its lifecycle. What is the importance of ssDNA and dsDNA of M13 shown here in RDT?
      

16. Why E.coli is not a suitable host for expression of eukaryotic proteins?
17. Name any two plant and animal viral vectors
18. What is the function cos site of lambda DNA?
19. Which method of introduction of rDNA into host cell is depicted here"
        
20. How many DNa fragments will you get after completion of 12 cycles when initially 3 copies of DNA are taken as template.
21. At what temperature annealing in PCR takes place?
22. What is blotting in Southerrn Hybrdization?
23. Write any two advantages of the following library:
       
24. Write the principle of the techinque shown below:
         

25. Why cDNA lacks introns?